|
|
|
|
|
/listmainleft.gif) |
Link Board
|
/listmainright.gif) |
|
|
| The Institute For Genome Research |
|
|
|
|
|
| EMBL-EBI, Sanger institute ¿¬ÇÕ Áö³ð ¼¹ö |
|
|
|
|
|
| The Human Genome Organisation |
|
|
|
|
|
A Database of Human Unidentified Gene-Encoded Large Proteins Analyzed
by Kazusa Human cDNA Project |
|
|
|
|
|
 |
 |
Human acidic ribosomal protein (HuPO)£ºHuman RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp
FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG
Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. |
|
|
|
|
|
 |
 |
| p53 Luciferase Reporter Stable Cell LineÀ» ÆÄ´Â °÷. |
|
|
|
|
|
±âº»ÀûÀÎ Tm, GC%¿Í 2ndary structure, self dimer, hetero dimer µîÀÇ ¿©ºÎ¸¦ È®ÀÎÇÒ ¼ö ÀÖÀ½
https://sg.idtdna.com/calc/analyzer
|
|
|
|
|
|
|
|
1 |
|
|
|
|
|
|
|