[Notice!!]

ID:
PW:

 

    

    

 

 

  


Total : 10 Article 1/1 Page
Total List (10)
Proteome/Metabolome (27)
Genome/Transcriptome (10)
Portal/Literature (9)
Others (9)
Utility (14)
Journal (38)
Structure (6)
Company (21)
Glycome (2)
  
  Link Board
  Genome/Transcriptome TIGR Visit : 3   
    http://www.tigr.org/ 2003/12/24   
The Institute For Genome Research
  Genome/Transcriptome ANGIS Visit : 3   
    http://morgan.angis.su.oz.au/ 2003/12/24   
Áö³ð °ü·Ã È£ÁÖ ¼­¹ö
  Genome/Transcriptome DDBJ Visit : 2   
    http://www.ddbj.nig.ac.jp/ 2003/12/24   
Áö³ð °ü·Ã ÀϺ» ¼­¹ö
  Genome/Transcriptome ENSEMBL Visit : 2   
    http://www.ensembl.org/ 2003/12/24   
EMBL-EBI, Sanger institute ¿¬ÇÕ Áö³ð ¼­¹ö
  Genome/Transcriptome HUGO Visit : 3   
    http://www.gene.ucl.ac.uk/ 2003/12/24   
The Human Genome Organisation
  Genome/Transcriptome HUGE Visit : 5   
    http://www.kazusa.or.jp/huge/ 2003/12/24   
A Database of Human Unidentified Gene-Encoded Large Proteins Analyzed
by Kazusa Human cDNA Project
  Genome/Transcriptome Luciferase promoter product Visit : 0   
    http://www.genecopoeia.com/eflyers/us/?utm_source=GeneCopoeia&utm_medium=email&utm_campaign=Un-Luc-May-12&utm_unique=YmFla0BjaGEuYWMua3I%253D%250A 2012/05/16   
GeneCopoeia site
  Genome/Transcriptome p53 Luciferase Reporter Stable Cell Lines Visit : 0   
    http://www.signosisinc.com/product/Luciferase_Reporter_Stable_Cell_Lines#376 2014/03/20   
p53 Luciferase Reporter Stable Cell LineÀ» ÆÄ´Â °÷.
  Genome/Transcriptome OligoAnalyzer Visit : 0   
    2016/12/05   
±âº»ÀûÀÎ Tm, GC%¿Í 2ndary structure, self dimer, hetero dimer µîÀÇ ¿©ºÎ¸¦  È®ÀÎÇÒ ¼ö ÀÖÀ½

https://sg.idtdna.com/calc/analyzer
  Genome/Transcriptome housekeeping gene (HuPO) Visit : 0   
    2021/07/12   
Human acidic ribosomal protein (HuPO)£ºHuman RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp

FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG

Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
1

Copyright 1999-2025 Zeroboard / skin by Riddu(ORG.DeadLife-SHAI)