[Notice!!]

ID:
PW:

 

    

    

 

 

  


Total : 136 Article 6/7 Page
Total List (136)
Proteome/Metabolome (27)
Genome/Transcriptome (10)
Portal/Literature (9)
Others (9)
Utility (14)
Journal (38)
Structure (6)
Company (21)
Glycome (2)
  
  Link Board
  Company Çѱ¹¼¼Æ÷ÁÖÀºÇà Visit : 0   
    http://cellbank.snu.ac.kr/index.htm 2004/03/10   
Tel 02-3668-7915
  Company Ambion Visit : 0   
    http://www.ambion.com/ 2004/03/10   
RNAi°ü·Ã
  Others °úÇбâ¼úÁ¤Ã¥¿¬±¸¿ø Visit : 1   
    http://www.stepi.re.kr/main/index.asp 2004/03/14   
°úÇÐ ±â¼ú¿¡ °ü·ÃµÈ ´Ù¾çÇÑ Åë°è ÀÚ·á°¡ ÀÖ½À´Ï´Ù.
  Genome/Transcriptome housekeeping gene (HuPO) Visit : 0   
    2021/07/12   
Human acidic ribosomal protein (HuPO)£ºHuman RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp

FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG

Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
  Structure IUCR Visit : 1   
    http://www.iucr.ac.uk/ 2004/03/14   
±¹Á¦ °áÁ¤ÇÐ ¿¬¸ÍÀÔ´Ï´Ù.
  Company ÄÚ¸Þµå Visit : 0   
    http://www.komed.com/ 2004/04/06   
Antibody Á¦Á¶ ȸ»ç
  Others Scieng Visit : 0   
    http://www.scieng.net/v2/index.php 2004/04/07   
°úÇбâ¼úÀο¬ÇÕ
  Glycome Glycoforum Visit : 0   
    http://www.glycoforum.gr.jp/index.html 2004/04/19   
Letin, proteoglycan, glycoprotein, glycolipid µîµî
  Glycome Science of Hyaluronan Today Visit : 1   
    http://www.glycoforum.gr.jp/science/hyaluronan/hyaluronanE.html 2004/04/19   
Hyaluronan
  Others ÇÁ·ÎÅäÄÝ ¿Â¶óÀÎ Visit : 0   
    http://www.protocol-online.org/ 2004/05/01   
°¢Á¾ ½ÇÇè ÇÁ·ÎÅäÄÝ¿¡ ´ëÇÑ Æ÷Å» »çÀÌÆ®
  Utility PSORT Visit : 0   
    http://psort.nibb.ac.jp/ 2004/05/14   
.
  Proteome/Metabolome Yonsei Proteome Research Center Visit : 1   
    http://proteomix.org/ 2004/06/11   
.
  Utility SUMOplot¢â Visit : 0   
    http://www.abgent.com/sumoplot.html 2004/07/01   
SUMOplot¢â can help you to explain larger MWs than expected on SDS gels due to attachment of SUMO protein (11kDa) at multiple positions of your protein.
  Portal/Literature Web of Science Visit : 0   
    http://www.isinet.com/products/citation/wos/ 2004/07/02   
The Web of Science provides seamless access to current and retrospective multidisciplinary information from approximately 8,500 of the most prestigious, high impact research journals in the world. Web of Science also provides a unique search method, cited reference searching. With it, users can navigate forward, backward, and through the literature, searching all disciplines and time spans to uncover all the information relevant to their research. Users can also navigate to electronic full-text journal articles.
  Company Santa Cruz Biotechnology Visit : 0   
    http://www.scbt.com/ 2004/07/09   
Antibody Á¦Á¶
  Others Ubiquitin & Ubiquitin-like Modifications in Health & Disease Visit : 0   
    http://www.ubmod.niddk.nih.gov/intro.html 2004/07/10   
.
  Proteome/Metabolome APAF Visit : 0   
    http://www.proteome.org.au/ 2004/07/31   
australian proteasome analysis facility
  Company Rockland Visit : 2   
    http://www.rockland-inc.com 2005/09/30   
443
  Company Reporter assay Visit : 0   
    http://genecopoeia.com/product/promoter-reporter-clones/?utm_source=un_pro_1011&utm_medium=email&utm_campaign=20111025&utm_unique=YmFla0BjaGEuYWMua3I%253D%250A 2011/11/01   
Reporter assay
  Genome/Transcriptome Luciferase promoter product Visit : 0   
    http://www.genecopoeia.com/eflyers/us/?utm_source=GeneCopoeia&utm_medium=email&utm_campaign=Un-Luc-May-12&utm_unique=YmFla0BjaGEuYWMua3I%253D%250A 2012/05/16   
GeneCopoeia site
[1][2][3][4][5] 6 [7]

Copyright 1999-2026 Zeroboard / skin by Riddu(ORG.DeadLife-SHAI)