|
|
|
|
|
/listmainleft.gif) |
Link Board
|
/listmainright.gif) |
|
|
| 과학 기술에 관련된 다양한 통계 자료가 있습니다. |
|
|
|
|
|
 |
 |
Human acidic ribosomal protein (HuPO)：Human RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp
FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG
Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. |
|
|
|
|
|
|
|
| Letin, proteoglycan, glycoprotein, glycolipid 등등 |
|
|
|
|
|
| SUMOplot™ can help you to explain larger MWs than expected on SDS gels due to attachment of SUMO protein (11kDa) at multiple positions of your protein. |
|
|
|
|
|
The Web of Science provides seamless access to current and retrospective multidisciplinary information from approximately 8,500 of the most prestigious, high impact research journals in the world. Web of Science also provides a unique search method, cited reference searching. With it, users can navigate forward, backward, and through the literature, searching all disciplines and time spans to uncover all the information relevant to their research. Users can also navigate to electronic full-text journal articles.
|
|
|
|
|
|
| australian proteasome analysis facility |
|
|
|
|
|
|
|
|
|
|
|
|
|
/subtop.gif)
/subline.gif)
/subbottom.gif)
/sorthit.gif)
/sortdate.gif)
/list.gif)
/prev.gif)
/next.gif)
/name_off.gif)
/subject_on.gif)
/content_on.gif)
/search_left.gif)
/search_right2.gif)