[Notice!!]

ID:
PW:

 

    

    

 

 

  


Total : 135 Article 1/7 Page
Total List (135)
Proteome/Metabolome (27)
Genome/Transcriptome (10)
Portal/Literature (9)
Others (8)
Utility (14)
Journal (38)
Structure (6)
Company (21)
Glycome (2)
  
  Link Board
  Genome/Transcriptome housekeeping gene (HuPO) Visit : 0   
    2021/07/12   
Human acidic ribosomal protein (HuPO):Human RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp

FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG

Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
  Proteome/Metabolome E3 ligase <-> substrate 찾는 사이트 Visit : 0   
    2021/01/27   
UbiBrower:
http://ubibrowser.ncpsb.org/ubibrowser/
  Journal figure 정리 필요시 tiff file 들을 하나의 파일로 합쳐 줄 수 있는 사이트 입니다 Visit : 0   
    https://products.aspose.app/pdf/ko/merger/tiff 2020/12/21   
https://products.aspose.app/pdf/ko/merger/tiff



한 피규어가 여러 tiff file로 나눠졌을지 그 파일들을 한 파일로 합쳐 주고 페이지가 넘어가도록 할 수 있도록 하는 사이트 입니다
  Journal Journal Impact factor Search Visit : 1   
    http://www.bioxbio.com/if/ 2018/12/28   
논문 IF 검색 사이트입니다.
  Proteome/Metabolome human에 있어 ubiquitination 되는 단백질들 Visit : 1   
    2018/10/06   
http://bioinfo.bjmu.edu.cn/hubi/
  Proteome/Metabolome protein-protein interaction을 볼 수 있는 사이트 정리 Visit : 1   
    2018/02/05   
**1. https://omictools.com/protein-protein-interaction-prediction-category
- protein-protein interaction을 볼 수 있는 여러가지 사이트를 종합하여 올린 사이트입니다.

2. http://cb.csail.mit.edu/cb/struct2net/webserver/

3. http://www.compbio.dundee.ac.uk/www-pips/

**4. http://mips.helmholtz-muenchen.de/proj/ppi/
- 다른 PPI resources도 참고로 포함되어 있습니다.

*5. https://string-db.org
- 많이 사용되는 사이트입니다.

*6. https://www.ebi.ac.uk/intact/
- STRING처럼 많이 사용되는 사이트입니다.

7. https://thebiogrid.org
- 특정 protein의 binding proteins를 찾을 수 있습니다.

  Genome/Transcriptome OligoAnalyzer Visit : 0   
    2016/12/05   
기본적인 Tm, GC%와 2ndary structure, self dimer, hetero dimer 등의 여부를  확인할 수 있음

https://sg.idtdna.com/calc/analyzer
  Proteome/Metabolome http://www.genome.jp/tools/motif/ Visit : 2   
    2016/06/08   
protein sequence를 넣으면
motif 종류와 설명이 깔끔하게 잘 나와있는 tool입니다.
  Utility 특정 protein의 binding partner를 찾을 수 있는 site입니다. Visit : 1   
    http://thebiogrid.org/ 2016/03/29   
http://thebiogrid.org/
  Utility 이용가능한 Ubiquitination prediction tool Visit : 13   
    2014/10/02   
이미 link 되어있던 사이트 중 사용가능한 사이트와 새로 추가된 사이트의 주소를 link 합니다. ( 2021년 4월 5일)

http://www.ubpred.org (작동안됨)

http://csb.cse.yzu.edu.tw/UbiSite/ (작동안됨)

http://bdmpub.biocuckoo.org/prediction.php

http://202.195.183.4:8000/mUbiSiDa.php  (작동안됨)(reprod.njmu.edu.cn/mUbiSiDa)

http://www.jci-bioinfo.cn/iUbiq-Lys

http://protein.bio.unipd.it/rubi/

http://chemdp.com/ubipredictor.php (작동안됨)

http://csb.cse.yzu.edu.tw/UbiNet/(작동안됨)

http://omictools.com/ubiquitination-sites-category (작동안됨)

http://protein.cau.edu.cn/cksaap_ubsite (작동안됨)

http://bioinfo.ncu.edu.cn/ubiprober.aspx (작동안됨)

http://www.cbs.dtu.dk/services/NetChop/ 

http://ubihub.thesgc.org
  Genome/Transcriptome p53 Luciferase Reporter Stable Cell Lines Visit : 0   
    http://www.signosisinc.com/product/Luciferase_Reporter_Stable_Cell_Lines#376 2014/03/20   
p53 Luciferase Reporter Stable Cell Line을 파는 곳.
  Journal 논문 IF 검색을 위한 약어 검색 사이트 Visit : 0   
    http://jabbr.mannlib.cornell.edu/ 2013/12/16   
코넬대의 논문 약어 검색 링크
  Portal/Literature NC3Rs Visit : 1   
    http://www.nc3rs.org.uk/category.asp?catID=8 2013/12/03   
모든 mouse관련 정보를 찾을 수 있는 포털사이트
  Others Knockout mouse project Visit : 0   
    https://www.komp.org/ 2013/12/03   
Knockout mouse 관련 product 검색
  Proteome/Metabolome IntAact Visit : 1   
    http://www.ebi.ac.uk/intact/ 2013/11/29   
Bioinformatics site : Finding your protein substrates
  Company DUB assay Kit Visit : 0   
    http://www.promega.com/products/drug-discovery/protease-assays/dub_glo-protease-assay/ 2012/11/10   
DUB assay Kit 파는곳
  Genome/Transcriptome Luciferase promoter product Visit : 0   
    http://www.genecopoeia.com/eflyers/us/?utm_source=GeneCopoeia&utm_medium=email&utm_campaign=Un-Luc-May-12&utm_unique=YmFla0BjaGEuYWMua3I%253D%250A 2012/05/16   
GeneCopoeia site
  Company Reporter assay Visit : 0   
    http://genecopoeia.com/product/promoter-reporter-clones/?utm_source=un_pro_1011&utm_medium=email&utm_campaign=20111025&utm_unique=YmFla0BjaGEuYWMua3I%253D%250A 2011/11/01   
Reporter assay
  Company Rockland Visit : 2   
    http://www.rockland-inc.com 2005/09/30   
443
  Company Abgent Visit : 2   
    http://www.abgent.com 2005/09/30   
111
1 [2][3][4][5][6][7]

Copyright 1999-2021 Zeroboard / skin by Riddu(ORG.DeadLife-SHAI)