|
|
|
|
|
/listmainleft.gif) |
Link Board
|
/listmainright.gif) |
|
|
 |
 |
Human acidic ribosomal protein (HuPO)£ºHuman RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp
FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG
Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. |
|
|
|
|
|
 |
 |
https://products.aspose.app/pdf/ko/merger/tiff
ÇÑ ÇDZԾ ¿©·¯ tiff file·Î ³ª´²Á³À»Áö ±× ÆÄÀϵéÀ» ÇÑ ÆÄÀÏ·Î ÇÕÃÄ ÁÖ°í ÆäÀÌÁö°¡ ³Ñ¾î°¡µµ·Ï ÇÒ ¼ö ÀÖµµ·Ï ÇÏ´Â »çÀÌÆ® ÀÔ´Ï´Ù |
|
|
|
|
|
³í¹® IF °Ë»ö »çÀÌÆ®ÀÔ´Ï´Ù.
|
|
|
|
|
|
**1. https://omictools.com/protein-protein-interaction-prediction-category
- protein-protein interactionÀ» º¼ ¼ö ÀÖ´Â ¿©·¯°¡Áö »çÀÌÆ®¸¦ Á¾ÇÕÇÏ¿© ¿Ã¸° »çÀÌÆ®ÀÔ´Ï´Ù.
2. http://cb.csail.mit.edu/cb/struct2net/webserver/
3. http://www.compbio.dundee.ac.uk/www-pips/
**4. http://mips.helmholtz-muenchen.de/proj/ppi/
- ´Ù¸¥ PPI resourcesµµ Âü°í·Î Æ÷ÇԵǾî ÀÖ½À´Ï´Ù.
*5. https://string-db.org
- ¸¹ÀÌ »ç¿ëµÇ´Â »çÀÌÆ®ÀÔ´Ï´Ù.
*6. https://www.ebi.ac.uk/intact/
- STRINGó·³ ¸¹ÀÌ »ç¿ëµÇ´Â »çÀÌÆ®ÀÔ´Ï´Ù.
7. https://thebiogrid.org
- ƯÁ¤ proteinÀÇ binding proteins¸¦ ãÀ» ¼ö ÀÖ½À´Ï´Ù.
8. http://www.hitpredict.org/
-Protein-protein interactions from IntAct, BioGRID, MINT, DIP, MatrixDB, InnateDB are combined, annotated and scored. The reliability score is calculated based on the experimental details of each interaction and the sequence, structure and functional annotations of the interacting proteins.
2023.12.08
|
|
|
|
|
|
 |
 |
±âº»ÀûÀÎ Tm, GC%¿Í 2ndary structure, self dimer, hetero dimer µîÀÇ ¿©ºÎ¸¦ È®ÀÎÇÒ ¼ö ÀÖÀ½
https://sg.idtdna.com/calc/analyzer
|
|
|
|
|
|
protein sequence¸¦ ³ÖÀ¸¸é
motif Á¾·ù¿Í ¼³¸íÀÌ ±ò²ûÇÏ°Ô Àß ³ª¿ÍÀÖ´Â toolÀÔ´Ï´Ù. |
|
|
|
|
|
 |
 |
| p53 Luciferase Reporter Stable Cell LineÀ» ÆÄ´Â °÷. |
|
|
|
|
|
| ÄÚ³Ú´ëÀÇ ³í¹® ¾à¾î °Ë»ö ¸µÅ© |
|
|
|
|
|
| ¸ðµç mouse°ü·Ã Á¤º¸¸¦ ãÀ» ¼ö ÀÖ´Â Æ÷ÅлçÀÌÆ® |
|
|
|
|
|
| Knockout mouse °ü·Ã product °Ë»ö |
|
|
|
|
|
| Bioinformatics site : Finding your protein substrates |
|
|
|
|
|
|
|
|
|
|
|
|
|