|
|
|
|
|
/listmainleft.gif) |
Link Board
|
/listmainright.gif) |
|
|
**1. https://omictools.com/protein-protein-interaction-prediction-category
- protein-protein interaction을 볼 수 있는 여러가지 사이트를 종합하여 올린 사이트입니다.
2. http://cb.csail.mit.edu/cb/struct2net/webserver/
3. http://www.compbio.dundee.ac.uk/www-pips/
**4. http://mips.helmholtz-muenchen.de/proj/ppi/
- 다른 PPI resources도 참고로 포함되어 있습니다.
*5. https://string-db.org
- 많이 사용되는 사이트입니다.
*6. https://www.ebi.ac.uk/intact/
- STRING처럼 많이 사용되는 사이트입니다.
7. https://thebiogrid.org
- 특정 protein의 binding proteins를 찾을 수 있습니다.
8. http://www.hitpredict.org/
-Protein-protein interactions from IntAct, BioGRID, MINT, DIP, MatrixDB, InnateDB are combined, annotated and scored. The reliability score is calculated based on the experimental details of each interaction and the sequence, structure and functional annotations of the interacting proteins.
2023.12.08
|
|
|
|
|
|
 |
 |
|
|
Human acidic ribosomal protein (HuPO)：Human RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp
FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG
Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. |
|
|
|
|
|
|
|
https://products.aspose.app/pdf/ko/merger/tiff
한 피규어가 여러 tiff file로 나눠졌을지 그 파일들을 한 파일로 합쳐 주고 페이지가 넘어가도록 할 수 있도록 하는 사이트 입니다 |
|
|
|
|
|
기본적인 Tm, GC%와 2ndary structure, self dimer, hetero dimer 등의 여부를 확인할 수 있음
https://sg.idtdna.com/calc/analyzer
|
|
|
|
|
|
protein sequence를 넣으면
motif 종류와 설명이 깔끔하게 잘 나와있는 tool입니다. |
|
|
|
|
|
| p53 Luciferase Reporter Stable Cell Line을 파는 곳. |
|
|
|
|
|
| 모든 mouse관련 정보를 찾을 수 있는 포털사이트 |
|
|
|
|
|
| Knockout mouse 관련 product 검색 |
|
|
|
|
|
| Bioinformatics site : Finding your protein substrates |
|
|
|
|
|
|
|
|
|
|
|
|
|
/subtop.gif)
/subline.gif)
/subbottom.gif)
/sorthit.gif)
/sortdate.gif)
/list.gif)
/next.gif)
/name_off.gif)
/subject_on.gif)
/content_on.gif)
/search_left.gif)
/search_right2.gif)