[Notice!!]

ID:
PW:

 

    

    

 

 

  


Total : 135 Article 1/7 Page
Total List (135)
Proteome/Metabolome (27)
Genome/Transcriptome (10)
Portal/Literature (9)
Others (8)
Utility (14)
Journal (38)
Structure (6)
Company (21)
Glycome (2)
  
  Link Board
  Proteome/Metabolome E3 ligase <-> substrate 찾는 사이트 Visit : 0   
    2021/01/27   
UbiBrower:
http://ubibrowser.ncpsb.org/ubibrowser/
  Proteome/Metabolome protein-protein interaction을 볼 수 있는 사이트 정리 Visit : 1   
    2018/02/05   
**1. https://omictools.com/protein-protein-interaction-prediction-category
- protein-protein interaction을 볼 수 있는 여러가지 사이트를 종합하여 올린 사이트입니다.

2. http://cb.csail.mit.edu/cb/struct2net/webserver/

3. http://www.compbio.dundee.ac.uk/www-pips/

**4. http://mips.helmholtz-muenchen.de/proj/ppi/
- 다른 PPI resources도 참고로 포함되어 있습니다.

*5. https://string-db.org
- 많이 사용되는 사이트입니다.

*6. https://www.ebi.ac.uk/intact/
- STRING처럼 많이 사용되는 사이트입니다.

7. https://thebiogrid.org
- 특정 protein의 binding proteins를 찾을 수 있습니다.

  Genome/Transcriptome housekeeping gene (HuPO) Visit : 0   
    2021/07/12   
Human acidic ribosomal protein (HuPO):Human RPLPO
Gene Symbol: RPLPO
RefSeq: NM_001002.3
Amplicon Size: 119 bp

FP: TGGTCATCCAGCAGGTGTTCGA
RP: ACAGACACTGGCAACATTGCGG

Ribosomes, the organelles that ccce protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 60S subunit. The protein, which is the functional equivalent of the E. coli L10 ribosomal protein, belongs to the L10P family of ribosomal proteins. It is a neutral phosphoprotein with a C-terminal end that is nearly identical to the C-terminal ends of the acidic ribosomal phosphoproteins P1 and P2. The P0 protein can interact with P1 and P2 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. Transcript variants derived from alternative splicing exist; they encode the same protein. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome.
  Journal figure 정리 필요시 tiff file 들을 하나의 파일로 합쳐 줄 수 있는 사이트 입니다 Visit : 0   
    https://products.aspose.app/pdf/ko/merger/tiff 2020/12/21   
https://products.aspose.app/pdf/ko/merger/tiff



한 피규어가 여러 tiff file로 나눠졌을지 그 파일들을 한 파일로 합쳐 주고 페이지가 넘어가도록 할 수 있도록 하는 사이트 입니다
  Journal Journal Impact factor Search Visit : 1   
    http://www.bioxbio.com/if/ 2018/12/28   
논문 IF 검색 사이트입니다.
  Proteome/Metabolome human에 있어 ubiquitination 되는 단백질들 Visit : 1   
    2018/10/06   
http://bioinfo.bjmu.edu.cn/hubi/
  Genome/Transcriptome OligoAnalyzer Visit : 0   
    2016/12/05   
기본적인 Tm, GC%와 2ndary structure, self dimer, hetero dimer 등의 여부를  확인할 수 있음

https://sg.idtdna.com/calc/analyzer
  Proteome/Metabolome http://www.genome.jp/tools/motif/ Visit : 2   
    2016/06/08   
protein sequence를 넣으면
motif 종류와 설명이 깔끔하게 잘 나와있는 tool입니다.
  Utility 특정 protein의 binding partner를 찾을 수 있는 site입니다. Visit : 1   
    http://thebiogrid.org/ 2016/03/29   
http://thebiogrid.org/
  Utility 이용가능한 Ubiquitination prediction tool Visit : 13   
    2014/10/02   
이미 link 되어있던 사이트 중 사용가능한 사이트와 새로 추가된 사이트의 주소를 link 합니다. ( 2021년 4월 5일)

http://www.ubpred.org (작동안됨)

http://csb.cse.yzu.edu.tw/UbiSite/ (작동안됨)

http://bdmpub.biocuckoo.org/prediction.php

http://202.195.183.4:8000/mUbiSiDa.php  (작동안됨)(reprod.njmu.edu.cn/mUbiSiDa)

http://www.jci-bioinfo.cn/iUbiq-Lys

http://protein.bio.unipd.it/rubi/

http://chemdp.com/ubipredictor.php (작동안됨)

http://csb.cse.yzu.edu.tw/UbiNet/(작동안됨)

http://omictools.com/ubiquitination-sites-category (작동안됨)

http://protein.cau.edu.cn/cksaap_ubsite (작동안됨)

http://bioinfo.ncu.edu.cn/ubiprober.aspx (작동안됨)

http://www.cbs.dtu.dk/services/NetChop/ 

http://ubihub.thesgc.org
  Genome/Transcriptome p53 Luciferase Reporter Stable Cell Lines Visit : 0   
    http://www.signosisinc.com/product/Luciferase_Reporter_Stable_Cell_Lines#376 2014/03/20   
p53 Luciferase Reporter Stable Cell Line을 파는 곳.
  Journal 논문 IF 검색을 위한 약어 검색 사이트 Visit : 0   
    http://jabbr.mannlib.cornell.edu/ 2013/12/16   
코넬대의 논문 약어 검색 링크
  Portal/Literature NC3Rs Visit : 1   
    http://www.nc3rs.org.uk/category.asp?catID=8 2013/12/03   
모든 mouse관련 정보를 찾을 수 있는 포털사이트
  Others Knockout mouse project Visit : 0   
    https://www.komp.org/ 2013/12/03   
Knockout mouse 관련 product 검색
  Proteome/Metabolome IntAact Visit : 1   
    http://www.ebi.ac.uk/intact/ 2013/11/29   
Bioinformatics site : Finding your protein substrates
  Company DUB assay Kit Visit : 0   
    http://www.promega.com/products/drug-discovery/protease-assays/dub_glo-protease-assay/ 2012/11/10   
DUB assay Kit 파는곳
  Genome/Transcriptome Luciferase promoter product Visit : 0   
    http://www.genecopoeia.com/eflyers/us/?utm_source=GeneCopoeia&utm_medium=email&utm_campaign=Un-Luc-May-12&utm_unique=YmFla0BjaGEuYWMua3I%253D%250A 2012/05/16   
GeneCopoeia site
  Company Reporter assay Visit : 0   
    http://genecopoeia.com/product/promoter-reporter-clones/?utm_source=un_pro_1011&utm_medium=email&utm_campaign=20111025&utm_unique=YmFla0BjaGEuYWMua3I%253D%250A 2011/11/01   
Reporter assay
  Company Rockland Visit : 2   
    http://www.rockland-inc.com 2005/09/30   
443
  Company Abgent Visit : 2   
    http://www.abgent.com 2005/09/30   
111
1 [2][3][4][5][6][7]

Copyright 1999-2021 Zeroboard / skin by Riddu(ORG.DeadLife-SHAI)